1. If one creature homozygous for stripes was crossed with a creature heterozygous for stripes were crossed together, what would the results of the F1 generation be?
2. If the F1 generation of a creature that is heterozygous for big eye size is crossed with the the F1 generation of another creature also heterozygous for pointed horns were crossed together. What would their F1 generation be?
3. to be written
Saturday, February 27, 2010
DNA fingerprinting
ATGCTGCAGCTGCTGATCGATCGATCGATCGTGCATATGCTGTGCAGTCGGCTAGCTAGCTTCG
TACGACGTCGACGACTAGCTAGCTAGCTAGCTCGTATACGACACGTCAGCCGATCGATCGAAGC
TACGACGTCGACGACTAGCTAGCTAGCTAGCTCGTATACGACACGTCAGCCGATCGATCGAAGC
Friday, February 26, 2010
Creature Traits
2 single allele traits: weight and eye size
WEIGHT
Fat (F)
Skinny (f)
Medium (Ff)
EYE SIZE
Big (B)
Little (b)
Medium (Bb)
1 codominant trait: tail
Long (L)
Nub (l)
Short (Ll)
1 multiple allele trait: horns
Pointed (P)
Curved (p)
Rounded (Pp)
1 sex linked trait: spots
Spots (S)
No spots (s)
1 trait of incomplete dominance: stripes
Stripes (T)
No stripes (t)
WEIGHT
Fat (F)
Skinny (f)
Medium (Ff)
EYE SIZE
Big (B)
Little (b)
Medium (Bb)
1 codominant trait: tail
Long (L)
Nub (l)
Short (Ll)
1 multiple allele trait: horns
Pointed (P)
Curved (p)
Rounded (Pp)
1 sex linked trait: spots
Spots (S)
No spots (s)
1 trait of incomplete dominance: stripes
Stripes (T)
No stripes (t)
Stuff for Debate
DNA record keeping is not an invasion of privacy because DNA record keeping has many uses. DNA records can help scientists figure out problems in communities. For example, if a certain amount of people are being affected by something it can be shown through their DNA and if those records are kept scientists can find the gene that is causing the problem and they might be able to stop whatever is causing that problem. DNA record keeping can be used to catch criminals because when they have children their DNA can be traced to them to help find where criminals are. DNA also is no different than fingerprinting and photographs so it should not really be a problem to keep it on a database. It is kept private and no one can see it unless they are permitted, these databases are also guarded to make sure no one can steal the DNA records.
Tuesday, February 23, 2010
4 Points For Debate
1. DNA is not an invasion of privacy
2. DNA record keeping is needed to help with criminals as well as a way to help with paternity tests and other things
3. DNA keeping can be helpful if there is something affecting an amount of people it can help scientists know how to help these people and find out what is happening
4. DNA record keeping is no different than fingerprinting or photographs which are taken all the time. (Prentics Hall 354)
2. DNA record keeping is needed to help with criminals as well as a way to help with paternity tests and other things
3. DNA keeping can be helpful if there is something affecting an amount of people it can help scientists know how to help these people and find out what is happening
4. DNA record keeping is no different than fingerprinting or photographs which are taken all the time. (Prentics Hall 354)
Monday, February 15, 2010
What is DNA records keeping?
DNA record keeping is something done to better the community/world. After a crime is committed the criminals DNA is kept in a database. Also when a person goes into the military their DNA is kept on a miltary database. Databases help catch the guilty, they also help set the innocent free. Without them criminals would be running loose......you would never know if the person you meet tomorrow is one.
Sunday, February 14, 2010
Subscribe to:
Posts (Atom)